fixed thy1-gfp mouse brain slice Search Results


female thy1 gfp line m transgenic mice  (Jackson Laboratory)
86
Jackson Laboratory female thy1 gfp line m transgenic mice
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Female Thy1 Gfp Line M Transgenic Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/a+b6+cyj+pl+thy1/pmc12011382-97-2-8
Average 86 stars, based on 1 article reviews
female thy1 gfp line m transgenic mice - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
rat anti gfp  (Proteintech)
93
Proteintech rat anti gfp
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Rat Anti Gfp, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/FITC+Anti-mouse+CD90%2E2/pm28576968-154-138-140
Average 93 stars, based on 1 article reviews
rat anti gfp - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
gaagtcgtgctgcttcatgtggtcgg thy1 gfp amplicons  (New England Biolabs)
97
New England Biolabs gaagtcgtgctgcttcatgtggtcgg thy1 gfp amplicons
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Gaagtcgtgctgcttcatgtggtcgg Thy1 Gfp Amplicons, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/Endonuclease+V/us12049480-667-65-76
Average 97 stars, based on 1 article reviews
gaagtcgtgctgcttcatgtggtcgg thy1 gfp amplicons - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
thy1 gfp line m transgenic mouse  (Jackson Laboratory)
86
Jackson Laboratory thy1 gfp line m transgenic mouse
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Thy1 Gfp Line M Transgenic Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/gfp+m+thy1/bio_rxiv__2025__10__11__681535-229-6-11
Average 86 stars, based on 1 article reviews
thy1 gfp line m transgenic mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
gfp m transgenic mice  (Jackson Laboratory)
86
Jackson Laboratory gfp m transgenic mice
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Gfp M Transgenic Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/foxp3+gfp+mice/pm41396874-33-0-25
Average 86 stars, based on 1 article reviews
gfp m transgenic mice - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
mscv thy1 1  (Addgene inc)
93
Addgene inc mscv thy1 1
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Mscv Thy1 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/MSCV+PIG+(Puro+IRES+GFP)+(Plasmid+%2318751)/pmc06403283-333-22-23
Average 93 stars, based on 1 article reviews
mscv thy1 1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
adult  (Jackson Laboratory)
86
Jackson Laboratory adult
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Adult, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/adult/10__1364_slash_oe__405532-149-1-9
Average 86 stars, based on 1 article reviews
adult - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
goat anti gfp  (Rockland Immunochemicals)
95
Rockland Immunochemicals goat anti gfp
MFAO on imaging <t>of</t> <t>Thy1-GFP</t> line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.
Goat Anti Gfp, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fixed+thy1-gfp+mouse+brain+slice/GFP+(GOAT)+Antibody+Biotin+Conjugated/pmc03261162-8-3-13
Average 95 stars, based on 1 article reviews
goat anti gfp - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


MFAO on imaging of Thy1-GFP line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.

Journal: Optics Express

Article Title: Modal focal adaptive optics for Bessel-focus two-photon fluorescence microscopy

doi: 10.1364/OE.541033

Figure Lengend Snippet: MFAO on imaging of Thy1-GFP line M brain slices. (a),(e) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.4-NA Bessel focus by MFAO. (b),(f) Bessel-focus 2PFM images of the neuronal structures without AO, with AO correction in (a),(e), respectively, and without artificial aberration. Lateral pixel size: 0.5 µm. (c),(g) Zoomed-in images of white dashed boxes in (b),(f) (left) and signal profiles along white dashed lines (right). Lateral pixel size: 0.2 µm. (d),(h) Spectral power in the spatial frequency domain of the images in (c),(g) (left) and their radially averaged profiles (right). Dashed circle: (0.667 µm) -1 . Post-objective power: 47.5 mW for (b),(c), 46.5 mW for (f),(g). AU: arbitrary unit.

Article Snippet: Male and female Thy1-GFP line M transgenic mice (Jackson Laboratories, stock no. 007788, > 2 months old) were housed in cages (in groups of 1-5 before surgeries and in pairs or singly housed after) under a reverse light cycle.

Techniques: Imaging

MFAO application on in vivo imaging of Thy1-GFP line M mice. (a) Pupil-plane corrective phase and focal-plane SLM1 phase pattern for 0.6-NA Bessel focus by MFAO. (b),(e) Bessel-focus 2PFM images of dendritic structures acquired without and with AO correction in (a). Lateral pixel size: 0.5 µm. (c),(f) Spectral power in the spatial frequency domain of the images in (b),(e) (left) and their radially averaged profiles (right). Dashed circle: (1 µm) -1 . (d),(g) Signal profiles along white dashed lines in (b),(e). (h) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.6-NA Bessel focus by MFAO. (i) Bessel-focus 2PFM images of dendritic structures acquired without and with AO correction in (h) for 0.6-NA Bessel focus. Lateral pixel size: 0.5 µm. (j) Spectral power in the spatial frequency domain of images in (i) (left) and their radially averaged profiles (right). Dashed circle: (1 µm) -1 . (k) Signal profiles along white dashed lines in (i). Post-objective power: 48 mW for (b), 47.8 mW for (e), 47.5 mW for (i). AU: Arbitrary unit.

Journal: Optics Express

Article Title: Modal focal adaptive optics for Bessel-focus two-photon fluorescence microscopy

doi: 10.1364/OE.541033

Figure Lengend Snippet: MFAO application on in vivo imaging of Thy1-GFP line M mice. (a) Pupil-plane corrective phase and focal-plane SLM1 phase pattern for 0.6-NA Bessel focus by MFAO. (b),(e) Bessel-focus 2PFM images of dendritic structures acquired without and with AO correction in (a). Lateral pixel size: 0.5 µm. (c),(f) Spectral power in the spatial frequency domain of the images in (b),(e) (left) and their radially averaged profiles (right). Dashed circle: (1 µm) -1 . (d),(g) Signal profiles along white dashed lines in (b),(e). (h) Applied artificial astigmatism, pupil-plane corrective phase, and focal-plane SLM1 phase pattern for 0.6-NA Bessel focus by MFAO. (i) Bessel-focus 2PFM images of dendritic structures acquired without and with AO correction in (h) for 0.6-NA Bessel focus. Lateral pixel size: 0.5 µm. (j) Spectral power in the spatial frequency domain of images in (i) (left) and their radially averaged profiles (right). Dashed circle: (1 µm) -1 . (k) Signal profiles along white dashed lines in (i). Post-objective power: 48 mW for (b), 47.8 mW for (e), 47.5 mW for (i). AU: Arbitrary unit.

Article Snippet: Male and female Thy1-GFP line M transgenic mice (Jackson Laboratories, stock no. 007788, > 2 months old) were housed in cages (in groups of 1-5 before surgeries and in pairs or singly housed after) under a reverse light cycle.

Techniques: In Vivo Imaging